View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_low_6 (Length: 568)
Name: NF20469_low_6
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 297 - 551
Target Start/End: Original strand, 5752456 - 5752710
Alignment:
| Q |
297 |
aaataattgaatgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcatcccaggtatgtatgctagtcttgcatattttga |
396 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
5752456 |
aaataattgaacgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcctcccgggtatgtctgctagtcttgcatattttga |
5752555 |
T |
 |
| Q |
397 |
cacttatagaagggaaaggttgccacctaatttggtgcgagctcaacgagactacttcggtgctcatacatatgaaagggttgatatcgaggggtcgtac |
496 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5752556 |
ctcttatagaagggaaaggttgccagctaatttggtgcaagctcaacgagactacttcggtgctcatacatatgaaagggttgatatcgaggggtcgtac |
5752655 |
T |
 |
| Q |
497 |
catactaaatggttcaaacttgccaagaagttgaggatttagattactgtatttg |
551 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
5752656 |
catactgaatggttcaagcttgccaagcagtcgaggatttagattactgtgtttg |
5752710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 5752149 - 5752355
Alignment:
| Q |
15 |
gctgcaatggtctttaaatcaggtggttttggcgatatcttgaccgaccaacaagttgacaagaagcagttgattgatgatgttaggaaggctctttacg |
114 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5752149 |
gctgcaaaggtctttaaatcaggtggctttggcgatatcttgactgaccaacaagtagacaagaagcagttgattgatgatgttaggaaggctctttatg |
5752248 |
T |
 |
| Q |
115 |
cagccaagatctgtggttacgcataagggatgaatctgatcagtgcaaagagcactgaaaagggatgggatttggcattgggtgaacttgcccgtatttg |
214 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
5752249 |
cagccaagatttgtagttacgcacaagggatgaatctgatccgtgcaaagagtgctgaaaagggttgggatttggaattgggtgaacttgcccgtatttg |
5752348 |
T |
 |
| Q |
215 |
gaaagga |
221 |
Q |
| |
|
||||||| |
|
|
| T |
5752349 |
gaaagga |
5752355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 460 - 547
Target Start/End: Original strand, 5756533 - 5756620
Alignment:
| Q |
460 |
tcatacatatgaaagggttgatatcgaggggtcgtaccatactaaatggttcaaacttgccaagaagttgaggatttagattactgta |
547 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||| |||||||||| ||| ||| ||| ||||||||||||| ||||| |
|
|
| T |
5756533 |
tcatacatatgaaagggttgatatcgacgggtcttaccatactgaatggttcaagcttttaaagcagtcgaggatttagatttctgta |
5756620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 229 - 281
Target Start/End: Original strand, 5752399 - 5752452
Alignment:
| Q |
229 |
cgtacgacagaa-ccctaatcttacaaaccttcttgtggatccaaagttcgcaa |
281 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
5752399 |
cgtacgacagaaaccctaatctcgctaaccttcttgtggatccagagttcgcaa |
5752452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 401 - 474
Target Start/End: Original strand, 6078984 - 6079057
Alignment:
| Q |
401 |
tatagaagggaaaggttgccacctaatttggtgcgagctcaacgagactacttcggtgctcatacatatgaaag |
474 |
Q |
| |
|
|||||||||||||| |||||| | |||||||| | ||||||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
6078984 |
tatagaagggaaagattgccagcaaatttggtccaagctcaaagagattactttggtgctcatacatatgaaag |
6079057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University