View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20469_low_62 (Length: 233)
Name: NF20469_low_62
Description: NF20469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20469_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 20 - 141
Target Start/End: Original strand, 4444865 - 4444982
Alignment:
| Q |
20 |
gttagaggttgcgaagttacacagttagagtcaccggacacacagaggcctcttctgtttattgtcgttaatgatcattgctaattccttgtttgtcaac |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4444865 |
gttagaggttgcaaagttacacagttagagtcaccggacacac-gaggcctcttctgtttattgtcgttaatgatcattgc---ttccttgtttgtcaac |
4444960 |
T |
 |
| Q |
120 |
atcatccctctaagaaactcac |
141 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4444961 |
atcatccctctaagaaactcac |
4444982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 169 - 217
Target Start/End: Original strand, 4445016 - 4445064
Alignment:
| Q |
169 |
aaccatagtcttgtttccttccattgtttgatttttctgtcttgttcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4445016 |
aaccatagtcttgtttccttccattgtttgatttttctgtgttgttcat |
4445064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University