View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2046_low_31 (Length: 201)
Name: NF2046_low_31
Description: NF2046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2046_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 191
Target Start/End: Complemental strand, 8023337 - 8023167
Alignment:
| Q |
21 |
atagtcgagatggtttatgaaccccgccaacgtatatcgagaagatcaaagagattcaaagtgtgaatagtcaattgcctcttggaattggacttgagtc |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8023337 |
atagtcgagatggtttatcaaccccgccaacgtatatcgagaagatcaaagagattcaaagtgtgaatagtcaattgcctcttggaattggacttgagtc |
8023238 |
T |
|
| Q |
121 |
tcatttccctaatagtcctcctaacttgccttacatgagagcttcccttgatacccttcgcgccacaggtt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8023237 |
tcatttccctaatagtcctcctaacttgccttacatgagagcttcccttgatacccttcgcgccactggtt |
8023167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 21 - 178
Target Start/End: Complemental strand, 21543633 - 21543476
Alignment:
| Q |
21 |
atagtcgagatggtttatgaaccccgccaacgtatatcgagaagatcaaagagattcaaagtgtgaatagtcaattgcctcttggaattggacttgagtc |
120 |
Q |
| |
|
||||| |||||||||||| ||||||||||| |||||| ||||||| | |||||| |||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
21543633 |
atagtagagatggtttatcaaccccgccaaaatatatccagaagataagagagatccaaagttggaataagcaattgcctcttggaattggactcgagtc |
21543534 |
T |
|
| Q |
121 |
tcatttccctaatagtcctcctaacttgccttacatgagagcttcccttgataccctt |
178 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
21543533 |
tcattttcctaattttcctcctaacttgccttacatgagagcctcccttgatatcctt |
21543476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 60 - 178
Target Start/End: Original strand, 28153383 - 28153501
Alignment:
| Q |
60 |
agaagatcaaagagattcaaagtgtgaatagtcaattgcctcttggaattggacttgagtctcatttccctaatagtcctcctaacttgccttacatgag |
159 |
Q |
| |
|
|||| |||||| | ||||||||||||||||| |||||||| ||||||||||| || |||||||||||| || | |||| ||||| ||||||||||| |
|
|
| T |
28153383 |
agaaaatcaaacaaattcaaagtgtgaataggcaattgccgcttggaattggtctggagtctcatttctcttctctccctctcaactttccttacatgag |
28153482 |
T |
|
| Q |
160 |
agcttcccttgataccctt |
178 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
28153483 |
agcttccattgataccctt |
28153501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 170
Target Start/End: Complemental strand, 51222162 - 51222084
Alignment:
| Q |
92 |
caattgcctcttggaattggacttgagtctcatttccctaatagtcctcctaacttgccttacatgagagcttcccttg |
170 |
Q |
| |
|
|||||||||||| |||||| ||| |||| ||||| ||| | ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
51222162 |
caattgcctcttagaattgaactgaagtcccattttccttacagtcctcctaacttgacttacatgagggcttcccttg |
51222084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University