View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20470_high_24 (Length: 235)
Name: NF20470_high_24
Description: NF20470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20470_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 53842590 - 53842791
Alignment:
| Q |
19 |
gtgtgagaatgttgatgattaactgttcaacaacacaaaaatctgtgacttataagttattaacttttctaacttgtttgcattggaacataaatttgcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842590 |
gtgtgagaatgttgatgattaactgttcaacaacacaaaaatccgtgacttataagttattaacttttctaacttgtttgcattggaacataaatttgcc |
53842689 |
T |
 |
| Q |
119 |
agctaccaactttttctgaacttcaacgtgctctgaaccacatcatatgatgcttgtttgtgtctttcattcatttatttacaacccaaaatgcacattt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53842690 |
agctaccaactttttctgaacttcaacgtgctctgaaccacatcatatgatgcttgtttgtgtctttcattcatttatttacaacccaaaatgcacgttt |
53842789 |
T |
 |
| Q |
219 |
tt |
220 |
Q |
| |
|
|| |
|
|
| T |
53842790 |
tt |
53842791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University