View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20470_high_26 (Length: 226)
Name: NF20470_high_26
Description: NF20470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20470_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 11370143 - 11369950
Alignment:
| Q |
17 |
cataggggacaaaaactccatgcccaactgacccgacagctacatataaaataaaacaacacctaatttgcaaaactcaagtgttactggtacacccgtt |
116 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11370143 |
catagaggacaaaaactccatgcccaacagacccgacggctacatataaaataaaacaacacctaatttgcaaaactcaagtggtactggtacacccgtt |
11370044 |
T |
|
| Q |
117 |
ttcgaaaacaacacatcaatccctgcacctaatgtgtcaaatttcgtcaaaaaatgcaacttcaacttataaacatctcattacagcaacaaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11370043 |
ttcgaaaacaacacatcaatccctgcacctaatgtgtcaaatttcgtcaaaaaatgcaacttcaacttataaacatctcattacagcaacaaac |
11369950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University