View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20470_low_13 (Length: 327)
Name: NF20470_low_13
Description: NF20470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20470_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 10 - 311
Target Start/End: Original strand, 7499144 - 7499445
Alignment:
| Q |
10 |
gatgacaaatgcaaaaacaagaggtttagagttcagcaaggagatgtttttgtggtgcctaggtttcatccaatggctcaaatgtcatttgttaatcaga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499144 |
gatgacaaatgcaaaaacaagaggtttagagttcagcaaggagatgtttttgtggtgcctaggtttcatccaatggctcaaatgtcatttgttaatcagc |
7499243 |
T |
 |
| Q |
110 |
cacttgtttttatgggattcagcactgctgcaaagaaaaatcatcctcagtttttggctggtaaagaatctgtgctgcaaattctagacagagagatagt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499244 |
cacttgtttttatgggattcagcactgctgcaaagaaaaatcatcctcagtttttggctggtaaagaatctgtgctgcaaattctagacagagagatagt |
7499343 |
T |
 |
| Q |
210 |
tgctacctctttaggtgtaagcaatacaaccattgacaagcttttggagaaaccggatgattcgatcattttcgagtgtaattcttgtgcggaggaagag |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499344 |
tgctacctctttaggtgtaagcaatacaaccattgacaagcttttggagaaaccggatgattcgatcattttcgagtgtaattcttgtgcggaggaagag |
7499443 |
T |
 |
| Q |
310 |
ga |
311 |
Q |
| |
|
|| |
|
|
| T |
7499444 |
ga |
7499445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University