View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20470_low_18 (Length: 320)
Name: NF20470_low_18
Description: NF20470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20470_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 132 - 307
Target Start/End: Complemental strand, 31443117 - 31442942
Alignment:
| Q |
132 |
ccgattgattataatcaagtgaaaaaatgagctccggttaaagacagatcataagaagaatctgagattgaattttggttggaacaatcttgaaccaaat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31443117 |
ccgattgattataatcaagtgaaaaaatgagctccggttaaagacagatcataagaagaatctgagattgaattttggttggaacaatcttgaaccaaac |
31443018 |
T |
 |
| Q |
232 |
ataaagccgatctccggattaccacgattccttcttttacaaaccggtgggttaagaaacaaaaattcaatatatt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31443017 |
ataaagccgatctccggattaccacgattccttcttttacaaaccggtgggttaagaaacaaaaattcaatatatt |
31442942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University