View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20470_low_22 (Length: 282)
Name: NF20470_low_22
Description: NF20470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20470_low_22 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 42042180 - 42042436
Alignment:
| Q |
18 |
tgaggaatgtttgtcaattgatcaaatgaaattgcataacacttttaataaacaccacttaattattcactaacatatgcttatacataaatgcgcatgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042180 |
tgaggaatgtttgtcaattgatcaaatgaaattgcataacacttttaataaaccccacttaattattcactaacatatgcttatacataaatgcgcatgc |
42042279 |
T |
 |
| Q |
118 |
atatatatgtttgcttgttttggccttcatttcaaaccatgaaagtcaaaggtggcatgtgctagaaagtacttttgtcttctcatatatgaaaatcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
42042280 |
atatatatgtttgcttgttttggctttcatttcaaaccatgaaagtcaaaggtggcatgtgctagaaag-----ttgtcatc---catatgaaaatcaaa |
42042371 |
T |
 |
| Q |
218 |
ttctgtttctgtcaagtagcaagcatgttgtctagctctttcacatgtactacactcctagtcct |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42042372 |
ttctgtttctgtcaagtagcaagcatgttgtctagctctttcacatgtactacactcctagtcct |
42042436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University