View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20470_low_33 (Length: 205)
Name: NF20470_low_33
Description: NF20470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20470_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 12 - 189
Target Start/End: Complemental strand, 55573276 - 55573099
Alignment:
| Q |
12 |
agatgaaggagaaggctctggtaaaggtttattactcttagaccttcgcaggcgaagtttggtgaaacatgaacctgccattgaaactctagcaaagttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55573276 |
agatgaaggagaaggctctggtaaaggtttattactcttagaccttcgcaggcgaagtttggtgaaacatgaacctgccattgaaactctagcaaagttc |
55573177 |
T |
 |
| Q |
112 |
atgcctttggaaaatggtttattgttgtatgttatggttgatgatgcttatatgatcaaaagtacagactgtcaaaag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55573176 |
atgcctttggaaaatggtttattgttgtatgtaatggttgatgatgcttatatgatcaaaagtacagactgtcaaaag |
55573099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 66 - 126
Target Start/End: Complemental strand, 1359787 - 1359727
Alignment:
| Q |
66 |
aagtttggtgaaacatgaacctgccattgaaactctagcaaagttcatgcctttggaaaat |
126 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1359787 |
aagtttcgtgaaacatgaacctgccattgaaactctagcaaagttcatgtctttggaaaat |
1359727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 121 - 177
Target Start/End: Complemental strand, 33035633 - 33035577
Alignment:
| Q |
121 |
gaaaatggtttattgttgtatgttatggttgatgatgcttatatgatcaaaagtaca |
177 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33035633 |
gaaaatggtttattgttgtgtgttgtggttgatgatgcttatatgatcaaaagtaca |
33035577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 30845167 - 30845207
Alignment:
| Q |
117 |
tttggaaaatggtttattgttgtatgttatggttgatgatg |
157 |
Q |
| |
|
||||||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
30845167 |
tttggaaaaaggtttattgttgtgtgttgtggttgatgatg |
30845207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University