View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20470_low_34 (Length: 205)
Name: NF20470_low_34
Description: NF20470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20470_low_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 32 - 184
Target Start/End: Original strand, 10968633 - 10968785
Alignment:
| Q |
32 |
caaaggctgaacaaggtgattttggttgaggagatgaaggttgctttggaactgaaggattcaaaagacgggtttgtgagtggaaccgagttaggggatc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10968633 |
caaaggctgaacaaggtgattttggttgacgagatgaaggttgctttggaactgaaggattcaaaagacgggtttgtgagtggaaccgagttaggggatc |
10968732 |
T |
|
| Q |
132 |
gaattaaggaattaatggactccgataaagggaaagagattaggaaaattatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10968733 |
gaattaaggaattaatggactccgataaagggaaagagattaggaaaattatt |
10968785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 32 - 184
Target Start/End: Original strand, 10982583 - 10982735
Alignment:
| Q |
32 |
caaaggctgaacaaggtgattttggttgaggagatgaaggttgctttggaactgaaggattcaaaagacgggtttgtgagtggaaccgagttaggggatc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10982583 |
caaaggctgaacaaggtgattttggttgaggagatgaaggttgctttggaattgaaggattcaaaagacgggtttgtgagtggaaccgagttaggggatc |
10982682 |
T |
|
| Q |
132 |
gaattaaggaattaatggactccgataaagggaaagagattaggaaaattatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
10982683 |
aaattaaggaattaatggactccgataaggggaaagagattagacaaattatt |
10982735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 32 - 174
Target Start/End: Original strand, 11002813 - 11002955
Alignment:
| Q |
32 |
caaaggctgaacaaggtgattttggttgaggagatgaaggttgctttggaactgaaggattcaaaagacgggtttgtgagtggaaccgagttaggggatc |
131 |
Q |
| |
|
|||||| ||||||| |||||||||||||||| |||||||| ||||||||||| || | |||||| | |||||||||||||||| ||||| ||||| |
|
|
| T |
11002813 |
caaaggttgaacaaaatgattttggttgaggaaatgaaggtggctttggaactaaatgggtcaaaaaaagggtttgtgagtggaaatgagttgggggaga |
11002912 |
T |
|
| Q |
132 |
gaattaaggaattaatggactccgataaagggaaagagattag |
174 |
Q |
| |
|
|| ||||||| || ||||| || || ||||||||||||||||| |
|
|
| T |
11002913 |
gagttaaggagttgatggaatcagaaaaagggaaagagattag |
11002955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 174
Target Start/End: Original strand, 11079996 - 11080096
Alignment:
| Q |
74 |
gctttggaactgaaggattcaaaagacgggtttgtgagtggaaccgagttaggggatcgaattaaggaattaatggactccgataaagggaaagagatta |
173 |
Q |
| |
|
||||||||| |||| || |||||||| ||||||||||||| || ||||| ||||| || ||||||| || ||||| || || || ||||||||| ||| |
|
|
| T |
11079996 |
gctttggaattgaatgagtcaaaagatgggtttgtgagtgaaaatgagttgggggagagagttaaggagttgatggaatcagaaaaggggaaagaggtta |
11080095 |
T |
|
| Q |
174 |
g |
174 |
Q |
| |
|
| |
|
|
| T |
11080096 |
g |
11080096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University