View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20472_low_3 (Length: 240)
Name: NF20472_low_3
Description: NF20472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20472_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 6354934 - 6354794
Alignment:
| Q |
16 |
agaccaaccacaaggaaacaaggtgaaccgccccactgtccacaacaccaaacaatggtcaatcgcaggatacaatctcgtggattccacgaccattcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354934 |
agaccaaccacaaggaaacaaggtgaaccgccccactgtccacaacaccaaacaatggtcaatcgcaggatacaatctcgtggattccacgaccattcat |
6354835 |
T |
 |
| Q |
116 |
agaacatacagggagagacagatggaacctgtacatagtcc |
156 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
6354834 |
agaacatacagggagaggcagatggaacttgtacatagtcc |
6354794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University