View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20473_high_26 (Length: 338)
Name: NF20473_high_26
Description: NF20473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20473_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 226 - 323
Target Start/End: Original strand, 8521990 - 8522087
Alignment:
| Q |
226 |
gtgtttaaaaagaacaagtttttgtatttattggattggataccttttgtaaaacacaattctgtaccaattatgtaccaaataagccagaacagaat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
8521990 |
gtgtttaaaaagaacaagagtttgtatttattggattggataccttttgtaaaacacaattttgtaccaattatgcaccaaataagccaaaacagaat |
8522087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University