View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20473_high_28 (Length: 313)
Name: NF20473_high_28
Description: NF20473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20473_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 8652344 - 8652449
Alignment:
| Q |
1 |
taagaaagttcgtagtaatattaaacttattaatagttgtttgttattgatttacaagttcactctttggaagagaaaattggtttatgtttccatctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8652344 |
taagaaagttcgtagtaatattaaacttattaatagttgtttgttattgatttacaagtttactctttagaagagaaaattggtttatgtttccatctta |
8652443 |
T |
 |
| Q |
101 |
ctattt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
8652444 |
ctattt |
8652449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 186 - 297
Target Start/End: Original strand, 8652490 - 8652603
Alignment:
| Q |
186 |
gaggattttatattttgggatgaagttagtaatgtgtactacttgatcaaatattcaaacttggattttctacggtagtaaaaggccaaagttgacaca- |
284 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8652490 |
gaggattttatatttagggatgaagttagtaatgtgtactacttgatcaaatattcgaacttggattttctacggtagtaaaaggccaaagttgacacag |
8652589 |
T |
 |
| Q |
285 |
-gttgcgcaacatg |
297 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8652590 |
tgttgcgcaacatg |
8652603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University