View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20473_high_42 (Length: 214)
Name: NF20473_high_42
Description: NF20473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20473_high_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 4261193 - 4261397
Alignment:
| Q |
1 |
atcaacatttctgcggtacctatggtttgaatggtggccttagaactgtgtatgcttaggcctccaccttgtttcttgctttgagatcaacatcagcaat |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4261193 |
atcaacatttctgcggtatctatggtttgaatggtggccttagaactgtttatgcttaggccttcaccttgtttcttcctttcagatcaacatcagcaat |
4261292 |
T |
|
| Q |
101 |
cagcatatcagaagtaaatgagattggttgaatgagtcaatctgcacaaactagcaaataaaaaagcatatgatcttttatgatctactcttattctatt |
200 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261293 |
cagcatatcagcagtaaatgagaacagttgaatgagtcaatctgcacaaatgaccaaataaaaaagcatatgatcttttatgatctactcttattctatt |
4261392 |
T |
|
| Q |
201 |
cttct |
205 |
Q |
| |
|
||||| |
|
|
| T |
4261393 |
cttct |
4261397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 4268069 - 4268129
Alignment:
| Q |
1 |
atcaacatttctgcggtacctatggtttgaatggtggccttagaactgtgtatgcttaggc |
61 |
Q |
| |
|
||||||||| | |||||| |||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
4268069 |
atcaacattgccgcggtatctattgtttgaatggtggccttagaactttgtatgtttaggc |
4268129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 200
Target Start/End: Complemental strand, 4037940 - 4037906
Alignment:
| Q |
166 |
gcatatgatcttttatgatctactcttattctatt |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4037940 |
gcatatgatcttttatgatctactcatattctatt |
4037906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 4300980 - 4301056
Alignment:
| Q |
1 |
atcaacatttctgcggtacctatggtttgaatggtggccttagaactgtgtatgcttaggcctccaccttgtttctt |
77 |
Q |
| |
|
||||||||||| | ||| || |||||||||||||||| |||||||| |||||| ||| || | |||| |||||||| |
|
|
| T |
4300980 |
atcaacatttcagaagtatctgtggtttgaatggtggctttagaactttgtatgtttatgctttcaccatgtttctt |
4301056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 9e-29; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 103 - 203
Target Start/End: Complemental strand, 24049693 - 24049593
Alignment:
| Q |
103 |
gcatatcagaagtaaatgagattggttgaatgagtcaatctgcacaaactagcaaataaaaaagcatatgatcttttatgatctactcttattctattct |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||||||| |||||| ||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24049693 |
gcatatcagaagtaaatgagaacggttgaatgagtcagtctatacaaactaccaaatagaaatgcatatgatcttttatgatctactcttattctaatct |
24049594 |
T |
|
| Q |
203 |
t |
203 |
Q |
| |
|
| |
|
|
| T |
24049593 |
t |
24049593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 103 - 203
Target Start/End: Complemental strand, 24052829 - 24052729
Alignment:
| Q |
103 |
gcatatcagaagtaaatgagattggttgaatgagtcaatctgcacaaactagcaaataaaaaagcatatgatcttttatgatctactcttattctattct |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||||||| |||||| ||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24052829 |
gcatatcagaagtaaatgagaacggttgaatgagtcagtctatacaaactaccaaatagaaatgcatatgatcttttatgatctactcttattctaatct |
24052730 |
T |
|
| Q |
203 |
t |
203 |
Q |
| |
|
| |
|
|
| T |
24052729 |
t |
24052729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 24102237 - 24102184
Alignment:
| Q |
1 |
atcaacatttctgcggtacctatggtttgaatggtggccttagaactgtgtatg |
54 |
Q |
| |
|
||||||||||| |||||| || |||||||||| |||||||||||||| |||||| |
|
|
| T |
24102237 |
atcaacatttccgcggtatctgtggtttgaatcgtggccttagaactttgtatg |
24102184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 24106466 - 24106410
Alignment:
| Q |
1 |
atcaacatttctgcggtacctatggtttgaatggtggccttagaactgtgtatgctta |
58 |
Q |
| |
|
|||||||||||||| || || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24106466 |
atcaacatttctgccgtgtctgtggtttgaatg-tggccttagaactgtgtatgctta |
24106410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University