View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20473_low_32 (Length: 270)
Name: NF20473_low_32
Description: NF20473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20473_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 14790614 - 14790855
Alignment:
| Q |
20 |
cttgggcttctgcagctatgtctcatgagattgatggagattctaataactcttactttgatcttccattggaattgatgaaatatggtagtgctattga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14790614 |
cttgggcttctgcagctatgtctcatgagattgatggagattctaataactcttactttgatcttccattggaattgatgaaatatggtagtgctattga |
14790713 |
T |
|
| Q |
120 |
agtagattcacctatttcttcatctttggtttatgaaaaagaccaacttaaaggtgttttgaaaaatggttcagctagaggcagtgctagaaaatcagag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14790714 |
agtagattcacctatttcttcatctttggtttatgaaaaagaccaacttaaaggtgttttgaaaaatggttcagctagaggcagtgctagaaaatcggag |
14790813 |
T |
|
| Q |
220 |
gtgtcgccacgacatgttcggttttctttatcatcttcttct |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14790814 |
gtgtcgccacgacatgttcggttttctttatcatcttcttct |
14790855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University