View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20473_low_38 (Length: 244)
Name: NF20473_low_38
Description: NF20473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20473_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 54011029 - 54010820
Alignment:
| Q |
14 |
attatacttaccttcatgtttaatagagactctttatcatcctcacatgccaatttttattagcacatcacaaatattagatttcagttgtcgttttcgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54011029 |
attatacttaccttcatgtttaatagagactctttatcatcctcacatgccaatttttattagcacatcacaaatattagatttcagttgtcgttttcgg |
54010930 |
T |
|
| Q |
114 |
aacaacttggtcatgaattcgacatctcacaagatgtacagagaaacatcttttgagatgtcaactccgtggacagttctactacaacttgtgaaattag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54010929 |
aacaacttggtcatgaattcgacatctcacaagatgtacagagaaacatattttgagatgtcaactccgtggacagttctactacaacttgtgaaattag |
54010830 |
T |
|
| Q |
214 |
tctatgtaat |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
54010829 |
tctatgtaat |
54010820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University