View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20474_low_4 (Length: 464)
Name: NF20474_low_4
Description: NF20474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20474_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 410; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 410; E-Value: 0
Query Start/End: Original strand, 16 - 444
Target Start/End: Original strand, 43522698 - 43523129
Alignment:
| Q |
16 |
cttttccccctaattgctaaccacacaaaaaatataacttgaagttgaagacataagggtgtcattgcgaatctatgttgggtacaacaactgatagtta |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43522698 |
ctttttcccctaattgctaaccacacaaaaaatataacttgaagttgaagacataagggtgtcattgcgaatctatgttgggtacaacaactgatagtta |
43522797 |
T |
 |
| Q |
116 |
actaactcaaaacagtgttactaactaagacattacatgcattaccactcat---ttcagcacccttggcccaatggaccagacatcctgaatcctgatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43522798 |
actaactcaaaacagtgttactaactaagacattacatgcattaccactcataatttcagcacccttggcccaatggaccagacatcctgaatcctgatc |
43522897 |
T |
 |
| Q |
213 |
cttcttagaccatgttctaagtctctgtcatcatctcatgcatggtggtgcattaccggtcattaccatagacataactccacgcatgtatgagtgtggg |
312 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43522898 |
cttcttagaccatcttctaagtctctgtcatcatctcatgcatggtggtgcattaccggtcattaccatagacataactccacgcatgtatgagtgtggg |
43522997 |
T |
 |
| Q |
313 |
ttttcttttgttttagtctcatctactcatgacacgtgttgtttgatgatttagtacatgctgactcgatcggtttcatatgcttatgtctcagaacaca |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43522998 |
ttttcttttgttttagtctcatctactcatgacacgtgttgtttgatgatttagtacatgctgactcgatcggtttcatatgcttatgtctcagaacaca |
43523097 |
T |
 |
| Q |
413 |
cctcacattgtcacatgcttgcttcctatatt |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43523098 |
cctcacattgtcacatgcttgcttcctatatt |
43523129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University