View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20475_low_3 (Length: 374)
Name: NF20475_low_3
Description: NF20475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20475_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 9e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 12 - 114
Target Start/End: Complemental strand, 21144698 - 21144596
Alignment:
| Q |
12 |
atgaactggtaaacttaggattttaatccaaacagttattttgctggccactaagcttggattccattccttcatctccctaaaatgagaatcccaccaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144698 |
atgaactggtaaacttaggattttaatccaaacagttcttttgctggccactaagcttggattccattccttcatctccctaaaatgagaatcccaccaa |
21144599 |
T |
 |
| Q |
112 |
aat |
114 |
Q |
| |
|
||| |
|
|
| T |
21144598 |
aat |
21144596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University