View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20475_low_8 (Length: 290)

Name: NF20475_low_8
Description: NF20475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20475_low_8
NF20475_low_8
[»] chr3 (1 HSPs)
chr3 (18-262)||(42186680-42186928)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 42186928 - 42186680
Alignment:
18 aggcatgaatcatgatgtcaactgcccataacaaactcatattattgattattcgatagatatcccacataatttctatcctccacgctatataaaaaac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||| ||||    
42186928 aggcatgaatcatgatgtcaactgcccataacaaactcatattattgattattcgatagatatcccac---atttctatcctccacgctatataacaaac 42186832  T
118 tacaatt------aaggcaacaactagttttgacataggcatcatctagcatttcgggtt-nnnnnnnnncacggaacaaagtgtatccatccctcacac 210  Q
    | |||||      |||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||    
42186831 tgcaattaaggcaaaggcaacaactagttttgacataggcatcatctagcatttcgggttacaaaaaaaacacggaacaaagtgtatccatccctcacac 42186732  T
211 tatgaataaaatttcatattgaaattgcatcgaaggccaccatccatccctt 262  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||    
42186731 tatgaataaaatttcatattgaaattgcatcgaaggccatcatccatccctt 42186680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University