View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20475_low_8 (Length: 290)
Name: NF20475_low_8
Description: NF20475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20475_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 42186928 - 42186680
Alignment:
| Q |
18 |
aggcatgaatcatgatgtcaactgcccataacaaactcatattattgattattcgatagatatcccacataatttctatcctccacgctatataaaaaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
42186928 |
aggcatgaatcatgatgtcaactgcccataacaaactcatattattgattattcgatagatatcccac---atttctatcctccacgctatataacaaac |
42186832 |
T |
 |
| Q |
118 |
tacaatt------aaggcaacaactagttttgacataggcatcatctagcatttcgggtt-nnnnnnnnncacggaacaaagtgtatccatccctcacac |
210 |
Q |
| |
|
| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42186831 |
tgcaattaaggcaaaggcaacaactagttttgacataggcatcatctagcatttcgggttacaaaaaaaacacggaacaaagtgtatccatccctcacac |
42186732 |
T |
 |
| Q |
211 |
tatgaataaaatttcatattgaaattgcatcgaaggccaccatccatccctt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42186731 |
tatgaataaaatttcatattgaaattgcatcgaaggccatcatccatccctt |
42186680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University