View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20475_low_9 (Length: 235)
Name: NF20475_low_9
Description: NF20475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20475_low_9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 40960139 - 40960357
Alignment:
| Q |
18 |
atatgtggtcattattttctgtgatgatgatttgaaggtagactgtaccaattaaaagcgttggagttggtacatgataggnnnnnnnnn-agcagcaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40960139 |
atatgtggtcattattttctgtgatgatgatttgaaggtagactgtaccaattaaaagcgttggagttggtacatgataggttctttttttagcagcaaa |
40960238 |
T |
|
| Q |
117 |
gaannnnnnnattgattatagactgcattgctattaagtacaagtagtactcgaccctcccnnnnnnntctaaccaactaaacaaacaccactaaattac |
216 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40960239 |
gaatttttttattgattatagactgcattgctattaagtacaagtagtactcgaccctcccaaaaaaatctaaccaactaaacaaacaccactaaattac |
40960338 |
T |
|
| Q |
217 |
ctaagcatacaatgtaaac |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40960339 |
ctaagcatacaatgtaaac |
40960357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University