View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20476_high_10 (Length: 343)
Name: NF20476_high_10
Description: NF20476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20476_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 264 - 334
Target Start/End: Complemental strand, 4880396 - 4880326
Alignment:
| Q |
264 |
aaagaatacaatcatagactatttgaccaactattgttccaacacaaaccaattgcttccctattcatctc |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
4880396 |
aaagaatacaatcatagactatttgaccaactattgttccaacacaaaccaactgcttcgctattcatctc |
4880326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University