View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20477_high_23 (Length: 301)

Name: NF20477_high_23
Description: NF20477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20477_high_23
NF20477_high_23
[»] chr5 (2 HSPs)
chr5 (22-286)||(41298069-41298333)
chr5 (124-177)||(15668848-15668901)
[»] chr3 (1 HSPs)
chr3 (124-177)||(5864281-5864334)
[»] chr1 (1 HSPs)
chr1 (124-177)||(34171265-34171318)
[»] chr6 (1 HSPs)
chr6 (100-171)||(526026-526097)


Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 22 - 286
Target Start/End: Original strand, 41298069 - 41298333
Alignment:
22 tttggcgaattaccaacactggtggctgggaaaaacaactttttctcaaagtcgaagggttcgtccgatggaggaaggtgcactcattgtggaaatgtca 121  Q
    |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||    
41298069 tttggccaattaccaacactggtggctggaaaaaacaactttttctcaaagtcgaagggttcgtctgatggaggaaagtgaactcattgtggaaatgtca 41298168  T
122 aacacactcgtgatacatgtttcaagttacatgggtatccagaatggtggcatgagctgcaagccaagaagaaaaaagacaacacaacacttgaggaagg 221  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41298169 gacacactcgtgatacatgtttcaagttacatgggtatccagaatggtggcatgagctgcaagccaagaagaaaaaagacaacacaacacttgaggaagg 41298268  T
222 cactggtaaagctgctgtagttactgccgagtctcaactctcacttgttcccatggccaatccct 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41298269 cactggtaaagctgctgtagttactgccgagtctcaactctcacttgttcccatggccaatccct 41298333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 177
Target Start/End: Complemental strand, 15668901 - 15668848
Alignment:
124 cacactcgtgatacatgtttcaagttacatgggtatccagaatggtggcatgag 177  Q
    ||||| ||||| ||||| |||||||| ||||||||||||||||||||| |||||    
15668901 cacacccgtgacacatgcttcaagttgcatgggtatccagaatggtggaatgag 15668848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 177
Target Start/End: Complemental strand, 5864334 - 5864281
Alignment:
124 cacactcgtgatacatgtttcaagttacatgggtatccagaatggtggcatgag 177  Q
    ||||| ||||| ||||| |||||||| ||||||||||||||||||||| |||||    
5864334 cacacccgtgacacatgcttcaagttgcatgggtatccagaatggtggaatgag 5864281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 177
Target Start/End: Complemental strand, 34171318 - 34171265
Alignment:
124 cacactcgtgatacatgtttcaagttacatgggtatccagaatggtggcatgag 177  Q
    ||||| ||||| ||||| |||||||| ||||||||||||||||||||| |||||    
34171318 cacacccgtgacacatgcttcaagttgcatgggtatccagaatggtggaatgag 34171265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 100 - 171
Target Start/End: Complemental strand, 526097 - 526026
Alignment:
100 tgcactcattgtggaaatgtcaaacacactcgtgatacatgtttcaagttacatgggtatccagaatggtgg 171  Q
    |||||||||||||||||  | || || || | ||| || |||||||||||||||||||| ||||||||||||    
526097 tgcactcattgtggaaagttgaagcatacacatgaaacttgtttcaagttacatgggtacccagaatggtgg 526026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University