View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20477_high_30 (Length: 262)
Name: NF20477_high_30
Description: NF20477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20477_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 23 - 245
Target Start/End: Original strand, 17346896 - 17347122
Alignment:
| Q |
23 |
actttatcacttgccagatccaactcatattagttaactactagcgagtagacgggtactaataattgaccg-ct------ttttctcgatacaaataat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | || ||| || ||||||||||||||||||| |
|
|
| T |
17346896 |
actttatcacttgccagatccaactcatattagttaactactagcgagtagacgg-tactaaca--tgcccgtctatccgcttttctcgatacaaataat |
17346992 |
T |
 |
| Q |
116 |
tgacgttacaaaaatttaagctataattnnnnnnnnntcattttgtagagatatttttgcgagttaaaataaatctgtttagaatgaatgtggaagcgac |
215 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
17346993 |
tgacgttacaaaattttaagctataattaaaaaaaattcattttgtagagatatttttgcgagttaaaataaatctgtttataatgaatgtgaaagcgac |
17347092 |
T |
 |
| Q |
216 |
ccgtttacataaaactcttacttcattgat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17347093 |
ccgtttacataaaactcttacttcattgat |
17347122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University