View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20477_high_34 (Length: 226)

Name: NF20477_high_34
Description: NF20477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20477_high_34
NF20477_high_34
[»] chr1 (1 HSPs)
chr1 (15-205)||(15334145-15334335)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 15334145 - 15334335
Alignment:
15 ataatacttggtccaatgggtggtggtatcggcggagtagatggcggtggaacaatatccggtccaggaggacacggaggaacaacatccggtggtggcc 114  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
15334145 ataatacttggtcctgtgggtggtggtatcggcggagtagatggcggtggaacaatatccggtccaggaggacacggaggaacgacatccggtggtggcc 15334244  T
115 gcggcggtactacatccggtatgggaaacggcatatcttgtccaggaggagttagtggtggttttggagcatccggtttcgggtttggatt 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15334245 gcggcggtactacatccggtatgggaaacggcatatcttgtccaggaggagttagtggtggttttggagcatccggtttcgggtttggatt 15334335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University