View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20477_high_34 (Length: 226)
Name: NF20477_high_34
Description: NF20477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20477_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 15334145 - 15334335
Alignment:
| Q |
15 |
ataatacttggtccaatgggtggtggtatcggcggagtagatggcggtggaacaatatccggtccaggaggacacggaggaacaacatccggtggtggcc |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15334145 |
ataatacttggtcctgtgggtggtggtatcggcggagtagatggcggtggaacaatatccggtccaggaggacacggaggaacgacatccggtggtggcc |
15334244 |
T |
 |
| Q |
115 |
gcggcggtactacatccggtatgggaaacggcatatcttgtccaggaggagttagtggtggttttggagcatccggtttcgggtttggatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15334245 |
gcggcggtactacatccggtatgggaaacggcatatcttgtccaggaggagttagtggtggttttggagcatccggtttcgggtttggatt |
15334335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University