View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20477_low_18 (Length: 341)
Name: NF20477_low_18
Description: NF20477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20477_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 23 - 326
Target Start/End: Original strand, 5465800 - 5466103
Alignment:
| Q |
23 |
gccccggctattctctccccggctgattctcatctaaaccgacctgacgataatgactcaaccccaactctcttttccaaacctgcgtcccatgatgacc |
122 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5465800 |
gccccggccattctctcaccggctgattctcatctaaaccgacctgacgataatgactcaactccaactctcttttccaaaccagcgtcccatgatgacc |
5465899 |
T |
 |
| Q |
123 |
cgaaccagttcttggagtcgggtcagtgtgtgatgaatgatgatatggtggagagggatcattttgtttcggatacccgtcccgaattaggtggcttgga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5465900 |
cgaaccagttcttggagtcgggtcagtgtgtgatgaatgatgatatggtggagagggatcattttgtttcggatacccgtcccgaattaggtgccttgga |
5465999 |
T |
 |
| Q |
223 |
cctgtttacgccttgtagtaattttatgcagaagaagatgaaaccgcagtatgataatattgtgaaatgcaatgaatccaaaaagttgacactctcacag |
322 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5466000 |
cctgtttacgccttgtagtagttttatgcagaagaagatgaaaccgcagtatgataatattgtgaaatgcaatgaatccaaaaagttgacaatctcacag |
5466099 |
T |
 |
| Q |
323 |
gttc |
326 |
Q |
| |
|
|||| |
|
|
| T |
5466100 |
gttc |
5466103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University