View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20477_low_19 (Length: 338)
Name: NF20477_low_19
Description: NF20477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20477_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 935255 - 935062
Alignment:
| Q |
11 |
agcagagatatgatcatgttcagtcttctttttactgatcttcaactatgatttattttgtttgatcgaggtgaagaacatacatattgctgaattttaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
935255 |
agcagagatatgatcatgttcagtcttctttttactgatcttcaactatgatttattttgtttgatcgaggtgaagaacatacttattgctgaattttaa |
935156 |
T |
|
| Q |
111 |
gtttgtggatgttctaaggacatcaactaatgagggtttgaatcaaaaaattagag-acagagtattttcatgtcttaagtactacattgttca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
935155 |
gtttgtggatgttctaaggacatcaactaatgagggtttgagtcaaaaaattagagaacagagtattttcatgtctcaagtactacattgttca |
935062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 63
Target Start/End: Complemental strand, 925793 - 925741
Alignment:
| Q |
11 |
agcagagatatgatcatgttcagtcttctttttactgatcttcaactatgatt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
925793 |
agcagagatatgatcatgttcagtcttctttctactgatattcaactatgatt |
925741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 283 - 327
Target Start/End: Complemental strand, 934981 - 934937
Alignment:
| Q |
283 |
caaatcttccataactttgaaggaacctaattttattgatatttt |
327 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
934981 |
caaattttccataactttgaaggaacctaattttattgatttttt |
934937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 11 - 68
Target Start/End: Complemental strand, 928125 - 928068
Alignment:
| Q |
11 |
agcagagatatgatcatgttcagtcttctttttactgatcttcaactatgatttattt |
68 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| || |||||| ||||||||||| |||| |
|
|
| T |
928125 |
agcagagatatgatcatgtttagtgttctttctaatgatctccaactatgattcattt |
928068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 11 - 68
Target Start/End: Complemental strand, 939044 - 938987
Alignment:
| Q |
11 |
agcagagatatgatcatgttcagtcttctttttactgatcttcaactatgatttattt |
68 |
Q |
| |
|
|||||||||||||| || |||||| |||||| ||||||||| ||||||||||| |||| |
|
|
| T |
939044 |
agcagagatatgattattttcagtgttctttctactgatctccaactatgattcattt |
938987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University