View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20477_low_24 (Length: 305)
Name: NF20477_low_24
Description: NF20477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20477_low_24 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 98 - 305
Target Start/End: Original strand, 32390223 - 32390428
Alignment:
| Q |
98 |
tgaagatatatgtctaaaacaaccaatgattattttggactaccataccctgacagaatcattaatcaaataaggtcaagttaatctatcaagggagggc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32390223 |
tgaagatatatgtctaaaacaaccaatgattattttgaactaccataccctgacagaatcatgaatcaaataaggtcaagttaatctatcaagggagggc |
32390322 |
T |
|
| Q |
198 |
atccttagcattnnnnnnnnntttgattggtcataatacatgtgttgctggagggccttttgagggtattgaaattggtttggtcagagagaatagcaat |
297 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32390323 |
atccttagcattaaaaaaaa--ttgattggtcataatacatgtgttgctggagggccttttgagggtattgaaattggtttggtcagagagaatagcaat |
32390420 |
T |
|
| Q |
298 |
tgcaagat |
305 |
Q |
| |
|
| |||||| |
|
|
| T |
32390421 |
tacaagat |
32390428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 32389420 - 32389506
Alignment:
| Q |
17 |
tgattgtcctacactagtgcatgtagaggaaggga------tgtcaggtttaagacccaaggatatagatcatcttggtatagttag |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32389420 |
tgattgtcctacactagtgcatgtagaggaagggacacatatgtcaggtttaagacccaaggatatagatcatcttggtatagttag |
32389506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University