View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20477_low_33 (Length: 250)
Name: NF20477_low_33
Description: NF20477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20477_low_33 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 36527153 - 36526914
Alignment:
| Q |
13 |
aatatttacatgtaattagcagttttaacatatttcaattgctgtttttcccatgcaaaatattactattcaattcaatatcagtatctttgat--gcaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36527153 |
aatatttacatgtaattagcagttttaacatatttcaattgctgtttttcccatgcaaaatattactattcaattcaatatcagtatctttgatatgcaa |
36527054 |
T |
 |
| Q |
111 |
tagccaacaatcaaaattccaatgcatcatctctttgtttcttcataggatttcaaacttcaggttgtctaagggacaactaactaatttactgcgccac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36527053 |
tagccaacaatcaaaattccaatgcatcatctctttgtttcttcataggatttcaaacttcaggttgtctaagggacaactaactaatttactgcgccac |
36526954 |
T |
 |
| Q |
211 |
ttttaaaaagctttcattataaattgtaactttcattgta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36526953 |
ttttaaaaagctttcattataaattgtaactttcattgta |
36526914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University