View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20478_low_5 (Length: 348)
Name: NF20478_low_5
Description: NF20478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20478_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 13 - 329
Target Start/End: Complemental strand, 488294 - 487978
Alignment:
| Q |
13 |
cagagatctagcagctaatgattgcagtaggtgtctactaagtgctattggagatataccaggttgctgttatgcctccattggtgcgagagttatgagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488294 |
cagagatctagcagctaatgattgcagtaggtgtctactaagtgctattggagatataccaggttgctgttatgcctccattggtgcgagagttatgagt |
488195 |
T |
 |
| Q |
113 |
cgtagctgttatctgagatatgaattctatccattttatcttggtgaaaaagaacaaacaaagtcttctaccaacctaggagggaaaagtaagcatttct |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488194 |
cgcagctgttatctgagatatgaattctatccattttatcttggtgaaaaagaacaaacaaagtcttctaccaacctaggagggaaaagtaagcatttct |
488095 |
T |
 |
| Q |
213 |
caagttgcaatacaattcttaaacattctgtcaaagctagttttgattgatcttttgtgcagataattcaagcaaaatatggatgattacagtcattgca |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488094 |
caagttgcaatacaattcttaaacattctgtcaaagctagttttgattgatcttttgtgcagataattcaagcaaaatatggatgattacagtcattgca |
487995 |
T |
 |
| Q |
313 |
gttggggtaggcttggt |
329 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
487994 |
gttggggtaggcttggt |
487978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University