View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20478_low_7 (Length: 247)
Name: NF20478_low_7
Description: NF20478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20478_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 231
Target Start/End: Complemental strand, 29672762 - 29672547
Alignment:
| Q |
16 |
acacccactaccaaaaacctccgacccacgtgtccaaattgccggtaacttcgccccagtaccggaacacccggtaacccaatctcttccaattaccggc |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672762 |
acacccactacccaaaacctccgacccacgtgttcaaattgccggtaacttcgccccagtaccggaacacccggtaacccaatctcttccaattaccggc |
29672663 |
T |
 |
| Q |
116 |
aaaatcccaaccaacattgacggtgtttacctccgtaacggcgccaatccactttacgagccagtagccggtcaccacttcttcgacggagacggtatgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672662 |
aaaatcccaaccaacattgacggtgtttacctccgtaacggcgccaatccactttacgagccagtagccggtcaccacttcttcgacggagacggtatgg |
29672563 |
T |
 |
| Q |
216 |
tccacgccgttaaatt |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29672562 |
tccacgccgttaaatt |
29672547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University