View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20478_low_8 (Length: 236)
Name: NF20478_low_8
Description: NF20478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20478_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 4 - 222
Target Start/End: Complemental strand, 53833703 - 53833490
Alignment:
| Q |
4 |
acttctcttatagaataacccgagttcgatttcagaagtcgttcattttaaagagaaaaagtgatttcttttctccgattcgaagattagtttcataaca |
103 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| ||||||||||||| |||||||||||| |||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
53833703 |
acttctcttatagaataacccaagttgaatttcaaaagtcgttcatttgaaagagaaaaagagatttcttttctgcgattcgaagattaatttcataaca |
53833604 |
T |
|
| Q |
104 |
aatcacctattctattcacacgatgctgatttacgatggtatccctgttcacatgctagcctatcggttgttgattgcatgatcttctcctgaagatttg |
203 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53833603 |
aatcacctattc-----acatgatgctgatttacgatggtatccctgttcacatgctagcctatcggttgttgattgcatgatcttctcctgaagatttg |
53833509 |
T |
|
| Q |
204 |
ttgaagtgttgatttaaat |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53833508 |
ttgaagtgttgatttaaat |
53833490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University