View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20478_low_9 (Length: 201)
Name: NF20478_low_9
Description: NF20478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20478_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 58 - 181
Target Start/End: Complemental strand, 883254 - 883131
Alignment:
| Q |
58 |
catttacagaacaagggtattgagacttttgagactactaatggcaacatcaaacgagttttcttctatgaccctgatggtaatcaagactaattaatta |
157 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
883254 |
catttacaggacaagggtattgagacttttgagactactaatggcaacatcaaacgagttttcttctatgaccctgatggtaatcaagactaattaatta |
883155 |
T |
|
| Q |
158 |
gtaatttttgtactataatttact |
181 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
883154 |
gtaatttttgtactataatttact |
883131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 95 - 140
Target Start/End: Complemental strand, 880606 - 880561
Alignment:
| Q |
95 |
ctaatggcaacatcaaacgagttttcttctatgaccctgatggtaa |
140 |
Q |
| |
|
|||||||||| ||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
880606 |
ctaatggcaaaatcaaacaagttttcttttttgaccctgatggtaa |
880561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University