View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_high_105 (Length: 224)
Name: NF20479_high_105
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_high_105 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 3101019 - 3100808
Alignment:
| Q |
1 |
tatgagtaaaagatatactagtaaccactaa-gcaatttgatggccaacacaatggtccctttaccaatatcnnnnnnnnnnnntatggacagaattaaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3101019 |
tatgagtaaaagatatactagtaaccactaaagcaatttgatggccaacacaatggtccctttaccaatatcaaaaagaaaaaatatggacagaattaaa |
3100920 |
T |
 |
| Q |
100 |
aaagt-gcttaaagcaaggagctaaattagcttttt-gaaactcaaaagataaagggacaaattaacaagccttctccccatctctttccatagaggcag |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3100919 |
aaagttgcttaaagcaaggagctaaattagcttttttgaaactcaaaagataaagggacaaattaacaagccttctccccatctctttccattgaggcag |
3100820 |
T |
 |
| Q |
198 |
gcttgttgatag |
209 |
Q |
| |
|
||||||| |||| |
|
|
| T |
3100819 |
gcttgttaatag |
3100808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University