View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_high_106 (Length: 223)
Name: NF20479_high_106
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_high_106 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 25 - 209
Target Start/End: Complemental strand, 16807189 - 16807005
Alignment:
| Q |
25 |
ggtcttgcacttcttgtattggcttgcttttaataatatatgatttcttattnnnnnnntgtacattttatagagtaattaatctgtatattttgtatat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16807189 |
ggtcttgcacttcttgtattggcttgcttttaataatatatgatttcttattaaaaaaatgtacattttatagagtaattaatctgtatattttgtatat |
16807090 |
T |
 |
| Q |
125 |
aatattaaaagtcaattccaccaaacgaaaaaatacataatttagccaacccaactaatcaaccacaccccataccctatgcttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16807089 |
aatattaaaagtcaattccaccaaacgaaaaaatacataatttagccaacccaactaatcaaccacaccccataccctatgcttc |
16807005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University