View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_high_21 (Length: 491)
Name: NF20479_high_21
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 410; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 410; E-Value: 0
Query Start/End: Original strand, 23 - 472
Target Start/End: Original strand, 19754963 - 19755412
Alignment:
| Q |
23 |
gaagactctgtgtcagtatttgaagggaggatattaccaaccaacataagatcaagggcctcaaaagggtcacgttctttcagcacatcaaactcctctt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19754963 |
gaagactctgtgtcagtatttgaagggaggatattaccaaccaacataagatcaagggcctcaaaagggtcacgttctttcagcacatcaaactcctctt |
19755062 |
T |
|
| Q |
123 |
gacttatagtcacagtggtagaatttgtcactggagtaggagattttgtctttggagaatcttgtttagattcatctttagattctttgacatattcttt |
222 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755063 |
gacttattgtcacactggtagaatttgtcactcgagtaggagattttgtctttggagaatcttgtttagattcatctttagattctttgacatattcttt |
19755162 |
T |
|
| Q |
223 |
acgaccttccccatcagtgtcagtgtgctttgtatcatcttcagagttcaacccacgaggttctttactttttccaccttcgaccggagatggaccccct |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
19755163 |
acgaccttccccatcagtgtcagtgtgctttgtatcatcttcagagttcaacccacgaggttctttactttttccactttcgaccagagatggaccccct |
19755262 |
T |
|
| Q |
323 |
tcattttcttcataaatgtgttgttgatcatcttcaacacttttagcattcaaatcttgaggaggttcagaaagcattttctctcggtcttcatcatctt |
422 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19755263 |
tcattttcttcatcaatgtgttgttgatcatcttcaacacttttatcattcaaatcttgaggaggttcagaaagcattttctctgggtcttcatcatctt |
19755362 |
T |
|
| Q |
423 |
tgggaggactagagtcaactatcatattgtcctcaaagatggggtcaatt |
472 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
19755363 |
tgggaggactagagtcaattatcatattgtcctcaaagatggggttaatt |
19755412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 296 - 396
Target Start/End: Complemental strand, 8135228 - 8135128
Alignment:
| Q |
296 |
ccaccttcgaccggagatggacccccttcattttcttcataaatgtgttgttgatcatcttcaacacttttagcattcaaatcttgaggaggttcagaaa |
395 |
Q |
| |
|
|||| |||||| |||||||||||||||| | ||| |||| | |||| || ||||||||||||| |||| | ||||| ||||||||| | | ||||||| |
|
|
| T |
8135228 |
ccactttcgactagagatggacccccttcgtcttcctcatcagtgtgatgctgatcatcttcaatacttctggcatttgaatcttgagaatgatcagaaa |
8135129 |
T |
|
| Q |
396 |
g |
396 |
Q |
| |
|
| |
|
|
| T |
8135128 |
g |
8135128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University