View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_high_52 (Length: 340)
Name: NF20479_high_52
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_high_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 326
Target Start/End: Original strand, 809315 - 809622
Alignment:
| Q |
19 |
attattgctttgctttccttaaaatggagtgactccatatttaccttttgggcatttgcatttgatttttgtacttgcaaattgcaatgaagctcttcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
809315 |
attattgctttgctttccttaaaatggagtgactccatatttaccttttgggcatttgcatttgatttttgtacttgcaaattgcaatgaagctcttcaa |
809414 |
T |
 |
| Q |
119 |
ctgtgctattgaaaaggtcaatattagagttgatttcagtattgttatttgttatatgctttaggatatttctgagtatagattcatcaaacatttttat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
809415 |
ctgtgctattgaaaaggtcaatattagagttgatttcagtattgttaattgttatatgctttaggatatttctgagtatagattcatctaacatttttat |
809514 |
T |
 |
| Q |
219 |
cttatgctttgttgttagctgtttattgagttcag-nnnnnnnnactcaagaatcaagctttgaaggaccttattttcctttagtctgacgaatattgta |
317 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
809515 |
cttatgctttgttgttagctg-ttattgagttcagtttttttttactcaagaatcaagctttgaaggaccttattttccttttgtctgacgaatattgta |
809613 |
T |
 |
| Q |
318 |
tagtataat |
326 |
Q |
| |
|
||||||||| |
|
|
| T |
809614 |
tagtataat |
809622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University