View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_high_61 (Length: 315)
Name: NF20479_high_61
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_high_61 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 57 - 315
Target Start/End: Original strand, 27694535 - 27694794
Alignment:
| Q |
57 |
gtatttgttgtctatcaacaatgtctcaat--tattagcggaagttgagctctttatcaattgtgggatatgagtcaactctttatcaatctaatcaacc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
27694535 |
gtatttgttgtctatcaacaatgtctcaatgatattagcggaagttgaactttttatcaattgtggaatatgagtcaactctttatcaatctaatcaatc |
27694634 |
T |
 |
| Q |
155 |
gattaatcaaaattgcaatttaatctcatattttaacatattactctgattcaatcatttaatcaaaaattcttttaaaaatattcattaaagagttaca |
254 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
27694635 |
gattaatgaaaattgcaatttaatctcatattttaacatattactc-gattcaatcatttaatcaaaaaaaattttaaaaatattgattaaagagttaca |
27694733 |
T |
 |
| Q |
255 |
aagtgtgttaagttgcctattgtatacatcaagaaaaatgaaactcaatttggtctctaac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27694734 |
aagtgtgttaagttgcctattgtatacatcaagaaaaatgaaactcaatttgatctctaac |
27694794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 27694501 - 27694534
Alignment:
| Q |
1 |
aggacacaatgtcccgagatatatagatctcaag |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27694501 |
aggacacaatgtcccgagatatatagatctcaag |
27694534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University