View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_high_77 (Length: 267)
Name: NF20479_high_77
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_high_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 2 - 251
Target Start/End: Complemental strand, 35329498 - 35329249
Alignment:
| Q |
2 |
ataggcctctcatggcagatgtagtgcagtctttggtgccattggtgaagactcacagatctccctcaaaagtaggcagcttctctagtttccaatcccc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35329498 |
ataggcctctcatggcagatgtagtgcagtctttggtgccattggtgaagactcacagatctccctcaaaagtaggcagcttctctagtttccaatcccc |
35329399 |
T |
|
| Q |
102 |
caagttgtcccctggccctgcgcaatatccagttgacgcaaatgtgtaatgtataatcagcatttaaattaaggattaacaccagacttaggacttagat |
201 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35329398 |
caagttgtcccctggccctgcccaatatccagttgatgcaaatgtgtaatgtataatcagcatttaaattaaggattaacaccagacttgggacttagat |
35329299 |
T |
|
| Q |
202 |
ttgtgtgcttggtagtctatggttaatttgtaatcttaaaccttatggtg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35329298 |
ttgtgtgcttggtagtctatggttaatttgtaatcttaaaccttatggtg |
35329249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University