View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_high_91 (Length: 240)
Name: NF20479_high_91
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_high_91 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 28669246 - 28669416
Alignment:
| Q |
18 |
acaatgcaaccgttgggattgaatggtatgatctttgaatagtcagaaattttctaactttatttttatttttatggattaacatgtccttatcaacacc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28669246 |
acaatgcaaccgttgggattgaatggtatgatctttgaatagtcagaaattttataactttatttttatttttatggattaacatgtccttatcaacacc |
28669345 |
T |
 |
| Q |
118 |
tccctcaaaaaatgtctttatcaacacttactaaaccttttcattaacttaatcacaactacacaattcct |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28669346 |
tccctcaaaaaatgtctttatcaacagttactaaaccttttcattaacttaatcacaactacacaattcct |
28669416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University