View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20479_high_95 (Length: 238)

Name: NF20479_high_95
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20479_high_95
NF20479_high_95
[»] chr8 (2 HSPs)
chr8 (149-209)||(6629370-6629430)
chr8 (18-53)||(6629525-6629560)


Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 149 - 209
Target Start/End: Complemental strand, 6629430 - 6629370
Alignment:
149 cattttggtaataatgtacattaattagcattgagacgggaattcgtgcccgtctatatcc 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6629430 cattttggtaataatgtacattaattagcattgagacgggaattcgtgcccgtctatatcc 6629370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 53
Target Start/End: Complemental strand, 6629560 - 6629525
Alignment:
18 ttttaaacgaatttcttcaattttctactcccacag 53  Q
    ||||||||||||||||||||||||||||||||||||    
6629560 ttttaaacgaatttcttcaattttctactcccacag 6629525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University