View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_106 (Length: 231)
Name: NF20479_low_106
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_106 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 134 - 217
Target Start/End: Original strand, 18763001 - 18763084
Alignment:
| Q |
134 |
aaaacattgattatcatcacgtcattcaattctcctcaaatcagcttttttattttagatagtattgattgctgccacattcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18763001 |
aaaacattgattatcatcacgtcattcaattcttctcaaatcagcttttttattttagatagtattgattgctgccacattcat |
18763084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 18762766 - 18762819
Alignment:
| Q |
30 |
tatggaataattcacaattattgataataatcatatttaattgctactattagt |
83 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18762766 |
tatggaataattcaccgttattgataaaaatcatatttaattgctactattagt |
18762819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University