View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20479_low_110 (Length: 224)

Name: NF20479_low_110
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20479_low_110
NF20479_low_110
[»] chr2 (1 HSPs)
chr2 (1-209)||(3100808-3101019)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 3101019 - 3100808
Alignment:
1 tatgagtaaaagatatactagtaaccactaa-gcaatttgatggccaacacaatggtccctttaccaatatcnnnnnnnnnnnntatggacagaattaaa 99  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||    
3101019 tatgagtaaaagatatactagtaaccactaaagcaatttgatggccaacacaatggtccctttaccaatatcaaaaagaaaaaatatggacagaattaaa 3100920  T
100 aaagt-gcttaaagcaaggagctaaattagcttttt-gaaactcaaaagataaagggacaaattaacaagccttctccccatctctttccatagaggcag 197  Q
    ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
3100919 aaagttgcttaaagcaaggagctaaattagcttttttgaaactcaaaagataaagggacaaattaacaagccttctccccatctctttccattgaggcag 3100820  T
198 gcttgttgatag 209  Q
    ||||||| ||||    
3100819 gcttgttaatag 3100808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University