View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20479_low_114 (Length: 219)

Name: NF20479_low_114
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20479_low_114
NF20479_low_114
[»] chr5 (1 HSPs)
chr5 (163-195)||(38072372-38072404)


Alignment Details
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 195
Target Start/End: Complemental strand, 38072404 - 38072372
Alignment:
163 cagggagatgtcatgcgagagtagtgagagggg 195  Q
    |||||||||||||||||||||||||||||||||    
38072404 cagggagatgtcatgcgagagtagtgagagggg 38072372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University