View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_115 (Length: 217)
Name: NF20479_low_115
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_115 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 194
Target Start/End: Original strand, 4143867 - 4144047
Alignment:
| Q |
14 |
agaagggaagagcatggcaccgtcaacgtagttcattacacactgtattgggcccgataataatgggcccatcttaatataagaggaaaagatgaggatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4143867 |
agaagggaagagcatggcaccgtcaacgtagttcattacacactgtattgggcccgataataatgggcccatcttaatataagaggaaaagatgaggatt |
4143966 |
T |
 |
| Q |
114 |
gttatttgcacccctctaatttacttctaacgcacctgtataagaaggggaaaaaagctcatgggctttgagcccaagccc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4143967 |
gttatttgcacccctctaatttacttctaacgcacctgtataagaaggggaaaaaagctcatgggctttgagcccaagccc |
4144047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University