View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_47 (Length: 361)
Name: NF20479_low_47
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 82 - 344
Target Start/End: Original strand, 23411556 - 23411818
Alignment:
| Q |
82 |
ggcttccccaagatcgccgcatagtgagaaaccttcacagcaacttaccaaataaaaactctttcttctattcagcttagttttcttagaatcttgaggt |
181 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
23411556 |
ggcttccccaagatcaccgcatagtgagaaaccttcacagcaacttaccaaataaaaactctttcttctattcatcttagtttgcttagaatcttgaggt |
23411655 |
T |
 |
| Q |
182 |
cctttatagctttgagagacattatcactcaaatatttannnnnnnncttctttcgtccaaagcaaaaacaccccataccaacccgtttctgaattctct |
281 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
23411656 |
cctttatagctttgagaaacattattactcaaatatttattttgtttcttctttcgtccaaagcaaaaacaccccataataacctgtttctgaattctct |
23411755 |
T |
 |
| Q |
282 |
atgtagttttgtttctcaattttatgaaagattgaaatcaaaggcatggcctttggtaaatat |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23411756 |
atgtagttttgtttctcaattttatgaaagattgaaatcaaaggcatggcctttgctaaatat |
23411818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University