View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_48 (Length: 360)
Name: NF20479_low_48
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 37191534 - 37191315
Alignment:
| Q |
3 |
catcactctacataacttaacttagcatcttcaatataaggtagagaattcaaatacccaacatgaacaagcttatgtaaatgataaaaaaggtgacnnn |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191534 |
catcactctacataacttaacttagcatcttcaatataaggtagagaattcaaatacccaacatgaacaagcttatgtaaatgataaaaaaggtgacaaa |
37191435 |
T |
|
| Q |
103 |
nnnntaagcatcttacaacgggagcagttcttggagtaataccaaaccgaccatgactagctgagtcatttgatctatatgcttcaacctatccaacatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191434 |
aaaataagcatcttacaacgggagcagttcttggagtaataccaaaccgaccatgactagctgagtcatttgatctatatgcttcaacctatccaacatt |
37191335 |
T |
|
| Q |
203 |
aattccttgttaaatcgtac |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37191334 |
aattccttgttaaatcgtac |
37191315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 279 - 345
Target Start/End: Complemental strand, 37191259 - 37191193
Alignment:
| Q |
279 |
ttgtacctaaaactaaggaactgttgagagaaaatgattgcggttatcttgaattagaagttacaaa |
345 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191259 |
ttgtacctaaaactaaggaactgttaagagaaaatgattgcggttatcttgaattagaagttacaaa |
37191193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University