View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_66 (Length: 297)
Name: NF20479_low_66
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 50 - 248
Target Start/End: Original strand, 44368361 - 44368559
Alignment:
| Q |
50 |
ataattatccgggtagggaaaacatttttcttgaatttaatttattccagataattaatgagataaattgggaagggatggaaattagtggaccttatta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44368361 |
ataattatccgggtagggaaaacatttttcttgaatttaatttattcctgataattaatgagataaattgggaagggatggaaattagtggaccttatta |
44368460 |
T |
|
| Q |
150 |
attgccaataggggtacgagattgatattttatgttaacaaaccattgtgagctgaatattcaattggttgatgtgacaaatcagaaaaagataatgct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44368461 |
attgccaataggggtacgagattgatattttatgttaacaaaccattgtgagctgaataatcaattggttgatgtgacaaatcagaaaaagataatgct |
44368559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 286
Target Start/End: Original strand, 44368577 - 44368623
Alignment:
| Q |
238 |
aagataatgctaaaaaacaaacttgggtgtgttagactattcttctctc |
286 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44368577 |
aagataatgctaaaaaacaaacttgg--gtgttagactattcttctctc |
44368623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University