View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_73 (Length: 284)
Name: NF20479_low_73
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 268
Target Start/End: Original strand, 32689024 - 32689292
Alignment:
| Q |
8 |
agattattcttcgtggagcctgtcgaattctggaaatgtttgtctt--------cggtgaataaattcttaagcacggtctgccttcacatgcctctgcg |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32689024 |
agattattcttcgtggagcctgttgaattctggaaatgtttgtcttcgactcttcggtgaataaattcttaagcacggtctgccttcacatgcctctgcg |
32689123 |
T |
|
| Q |
100 |
ccttatctatatctatgattcttctctatgtttgtggtctttgctctagattcatggttcatcattgttatgacttgattcgtgattgttcctttgtgag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32689124 |
ccttatctatatctatgattcttctctatgtttgtggtctctgctctagattcatggttcatcattgttatgacttgattcgtgattgttcctttgtgag |
32689223 |
T |
|
| Q |
200 |
ttgtgatcgtgatttgaagctttggtggaaaataattttcaatcatttatttagtggacctgaattaag |
268 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32689224 |
ttgtgatcgtgatttaaagctttggtggaaaataattttcaaccatttatttagtggacctgaattaag |
32689292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University