View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_75 (Length: 281)
Name: NF20479_low_75
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 37290086 - 37290339
Alignment:
| Q |
19 |
agaatgtgtaggcttgtacctagcccaaacccaaaacctttttgaaagcccaatcgaagttatttcagaagagttatataataaccaataacc------- |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37290086 |
agaatgtgtaggcttgtacctagcccaaacccaaaacctttttgaaagcccaattgaagttatttcagaagagttatataataaccaataaccaacaacc |
37290185 |
T |
 |
| Q |
112 |
aaccctaagcttcttcctcaactcctctatccccaaacaagttcccttcccactgtttcaggtcacaaatcaatcatccgatcttcaaccatggcttcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37290186 |
aaccctaagcttcttcctcaactcctttatccccaaaccagttcccttcccactgtttcaggtcacaaatcaatcatccgatcttcaaccatggcttcaa |
37290285 |
T |
 |
| Q |
212 |
gaaagtccgataaccctcactccggcgacggcgccagtcccgggttcgctctct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37290286 |
gaaagtccgataaccctcactccggcgacggcgccagtcccgggttcgctctct |
37290339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University