View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20479_low_76 (Length: 281)
Name: NF20479_low_76
Description: NF20479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20479_low_76 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 896816 - 896540
Alignment:
| Q |
1 |
ttctattatatatatgtaagtgatttattatgatatgtcaaccaatttaattggtttatcttctgacatgtgtaatatatgttatgtttgctcacctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
896816 |
ttctattatatatatgtaagtgatttattatgatatgtcaaccaatttaattggtttatcttctgacatgtgtaatatatgttatgtttgctcacctttt |
896717 |
T |
|
| Q |
101 |
tgcgttcattctaattatcagttgctttcagcaacaaaggtgattagaatttaaagggggcacatgagtttgcttgtttgtgaccttgaatgaattaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
896716 |
tgcgttcattctaattatcagttgctttcagcaacaaaggtgattagaatttaaagggggcacatgagtttgcttgtttgtgaccttgaatgaattaaca |
896617 |
T |
|
| Q |
201 |
gggaccatcaaattcttcaacttcttgttccaaatttcagtttctgtaatcattcctacaagtatatatgtggttct |
277 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
896616 |
gggaccatcaaattcttcgacttcttgttccaaatttcagtttatgtaatcattcctacaagtatatatgtggttct |
896540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University